Stem-loop sequence aae-mir-2a

AccessionMI0013443 (change log)
DescriptionAedes aegypti miR-2a stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention aae-mir-2a
(14 sentences)

Stem-loop
   ---u            ca    -     -         a     uuac  uu 
5'     gggaacuguuuc  cucu caaag ugguuguga augag    uc  g
       ||||||||||||  |||| ||||| ||||||||| |||||    ||   
3'     ucuuuggcaaag  gaga guuuc accgacacu uacuc    ag  a
   acgc            -c    a     g         a     ---u  ca 
Get sequence
Deep sequencing
53525 reads, 2.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.268: 888581-888677 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2a
aae-mir-71supercont1.268: 889378-889454 [-]
aae-mir-2csupercont1.268: 889085-889162 [-]
aae-mir-13supercont1.268: 888736-888819 [-]
aae-mir-2asupercont1.268: 888581-888677 [-]
aae-mir-2bsupercont1.268: 887244-887330 [-]
Database links

Mature sequence aae-miR-2a-5p

Accession MIMAT0014225
Previous IDsaae-miR-2a*
Sequence

15 - 

acucucaaagugguugugaaa

 - 35

Get sequence
Deep sequencing1856 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-miR-2a-3p

Accession MIMAT0014226
Previous IDsaae-miR-2a
Sequence

59 - 

uaucacagccagcuuugaagagc

 - 81

Get sequence
Deep sequencing51664 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).