Stem-loop sequence aae-mir-317-1

AccessionMI0013442 (change log)
DescriptionAedes aegypti miR-317-1 stem-loop
Gene family MIPF0000144; mir-317
Literature search

2 open access papers mention aae-mir-317-1
(6 sentences)

Stem-loop
   ga   a  uc      c       -   --     c     uugcau 
5'   gga uu  ggcuac gggauac acc  cugug ucgcu      u
     ||| ||  |||||| ||||||| |||  ||||| |||||       
3'   ccu aa  ccggug cucuaug ugg  gacac aguga      c
   ag   -  uc      a       g   uc     a     ucaaag 
Get sequence
Deep sequencing
373144 reads, 1.8e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.153: 2154700-2154791 [-]
intergenic
Database links

Mature sequence aae-miR-317

Accession MIMAT0014224
Sequence

55 - 

ugaacacagcuggugguaucu

 - 75

Get sequence
Deep sequencing744670 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).