Stem-loop sequence aae-mir-9c

AccessionMI0013436 (change log)
Previous IDsaae-mir-9
DescriptionAedes aegypti miR-9c stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention aae-mir-9c
(1 sentences)

Stem-loop
   ---c  a            cu    g     u  uga   uug 
5'     ug aucuuugguauu  agcu uagaa gu   gcu   u
       || ||||||||||||  |||| ||||| ||   |||   g
3'     ac uggagaccauga  ucga aucuu ua   ugg   a
   guca  c            uu    a     c  ---   uau 
Get sequence
Deep sequencing
4646 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Skalsky et al. experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1].

Database links

Mature sequence aae-miR-9c-5p

Accession MIMAT0014212
Previous IDsaae-miR-9
Sequence

6 - 

ucuuugguauucuagcuguaga

 - 27

Get sequence
Deep sequencing2597 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence aae-miR-9c-3p

Accession MIMAT0014213
Previous IDsaae-miR-9*
Sequence

56 - 

uaaagcuuuaguaccagagguc

 - 77

Get sequence
Deep sequencing1931 reads, 2 experiments
Evidence experimental; Illumina [1], 454 [2]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).
2