Stem-loop sequence aae-mir-184

AccessionMI0013433 (change log)
DescriptionAedes aegypti miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

4 open access papers mention aae-mir-184
(10 sentences)

Stem-loop
   cc    u     ua         -     g  c  c  -    ua 
5'   ggug auucg  cccuuauca uucuu cg cc gu guua  u
     |||| |||||  ||||||||| ||||| || || || ||||   
3'   ccac ugggc  gggaauagu aagag gc gg ca cggu  u
   uu    -     cc         c     -  a  u  g    ug 
Get sequence
Deep sequencing
1702994 reads, 8.72e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.496: 143366-143453 [-]
intergenic
Database links

Mature sequence aae-miR-184

Accession MIMAT0014207
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Deep sequencing1702890 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).