Stem-loop sequence rco-MIR399f

AccessionMI0013427 (change log)
DescriptionRicinus communis miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

2 open access papers mention rco-MIR399f
(7 sentences)

Stem-loop
   --   c                 a    -cu     caag gac 
5'   uua ugagcaagucuucuuug caga   uccac    c   a
     ||| ||||||||||||||||| ||||   |||||    |    
3'   aau acucguuuagaggaaac gucu   aggug    g   u
   uc   c                 c    auu     caaa gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973891.1: 134636-134722 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR399f
rco-MIR399bEQ973891.1: 142031-142136 [-]
rco-MIR399cEQ973891.1: 138457-138552 [-]
rco-MIR399fEQ973891.1: 134636-134722 [-]
Database links

Mature sequence rco-miR399f

Accession MIMAT0014201
Sequence

62 - 

ugccaaaggagauuugcucac

 - 82

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).