Stem-loop sequence rco-MIR399c

Accession MI0013424
Description Ricinus communis miR399c stem-loop
Gene family MIPF0000015; MIR399
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--uuaca       ac    a        c   cag  uaa    u    c 
       gggcaaa  cuuc uuggcaug ugc   ac   gaug ggga g
       |||||||  |||| |||||||| |||   ||   |||| ||||  
       cccguuu  gagg aaccguac acg   ug   cuau ccuu c
auagcgg       -a    a        u   ---  -ug    -    a 
Get sequence
Genome context
Coordinates (TIGR0.1) Overlapping transcripts
30026: 138457-138552 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR399c
rco-MIR399b 30026: 142031-142136 [-]
rco-MIR399c 30026: 138457-138552 [-]
rco-MIR399f 30026: 134636-134722 [-]

Mature sequence rco-miR399c

Accession MIMAT0014198
Sequence

71 - 

ugccaaaggagauuugcccgg

 - 91

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).