Stem-loop sequence rco-MIR399c

AccessionMI0013424 (change log)
DescriptionRicinus communis miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

2 open access papers mention rco-MIR399c
(7 sentences)

Stem-loop
   --uuaca       ac    a        c   cag  uaa    u    c 
5'        gggcaaa  cuuc uuggcaug ugc   ac   gaug ggga g
          |||||||  |||| |||||||| |||   ||   |||| ||||  
3'        cccguuu  gagg aaccguac acg   ug   cuau ccuu c
   auagcgg       -a    a        u   ---  -ug    -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973891.1: 138457-138552 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR399c
rco-MIR399bEQ973891.1: 142031-142136 [-]
rco-MIR399cEQ973891.1: 138457-138552 [-]
rco-MIR399fEQ973891.1: 134636-134722 [-]
Database links

Mature sequence rco-miR399c

Accession MIMAT0014198
Sequence

71 - 

ugccaaaggagauuugcccgg

 - 91

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).