Stem-loop sequence rco-MIR399a

Accession

MI0013422

Description

Ricinus communis miR399a stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

-- ug       c     gc           ----ag    cac  gc 
  u  uagggca cucuu  uuggcagguaa      ggga   ua  u
  |  ||||||| |||||  |||||||||||      ||||   ||  a
  a  gucccgu gagag  aaccguucguu      cccu   au  g
uc gu       u     ga           caauaa    aca  ac 

Genome context

• Coordinates (TIGR0.1): 30147: 464925-465017 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rco-MIR399a

• rco-MIR399d: 30147: 461879-461981 [+]
• rco-MIR399a: 30147: 464925-465017 [+]

Mature sequence rco-miR399a

• Accession: MIMAT0014196
• Sequence: 68 - ugccaaaggagaguugcccug - 88
• Evidence: experimental; RT-PCR [1]

References

1. PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).