Stem-loop sequence rco-MIR166b

Accession

MI0013387

Description

Ricinus communis miR166b stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

--  a        uu      cu   g         ---ua    u       u     ug 
  ug ggggaaug  gucugg  cga gucacuaau     gauc augauuu auuuu  c
  || ||||||||  ||||||  ||| |||||||||     |||| ||||||| |||||  u
  ac ccccuuac  cggacc  gcu cagugauug     cuag ugcuaga uagaa  u
ua  c        uu      ag   g         uuaug    u       -     uu 

Genome context

• Coordinates (TIGR0.1): 30068: 399591-399709 [+]
• Overlapping transcripts:

  intergenic

Mature sequence rco-miR166b

• Accession: MIMAT0014161
• Sequence: 94 - ucggaccaggcuucauucccc - 114
• Evidence: experimental; RT-PCR [1]

References

1. PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).