Stem-loop sequence ath-MIR2937

AccessionMI0013367 (change log)
DescriptionArabidopsis thaliana miR2937 stem-loop
Literature search

1 open access papers mention ath-MIR2937
(1 sentences)

Stem-loop
          ------   -ua     c       c       a   c       g  u   c                               a      a                      c        c    cuacaaaaca       c            aa   -aa                gcuagugaggccaguaccguaguuaauauu 
5' cauuuuc      cgu   guaac uauuggc auuugau acu caacaag ac aau aaacgagaaccauuugaugauguuaauggug aacaca gacccaucagcaaacucuccuc aaugguca acca          uuagauc uuuaaugacucc  caa   cucuuaugaugugggu                              g
   |||||||      |||   ||||| ||||||| ||||||| ||| ||||||| || ||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||| ||||          ||||||| ||||||||||||  |||   ||||||||||||||||                              a
3' guaaaag      gua   cauug auaaccg uaaacua uga guuguuu ug uua uuugcucuugguaaacuacuauaauuacuac uugugu cuggguaguuguuugggaggag uuacuagu uggu          aaucuag aaauuacugagg  guu   gagaauacuacaccua                              u
          caccau   ucg     u       a       c   u       a  c   a                               g      g                      a        u    ----------       a            aa   guc                aagaaaacaucugucagucugguuuuugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 13622416-13622838 [+]
intergenic
Database links

Mature sequence ath-miR2937

Accession MIMAT0014141
Sequence

254 - 

auaagagcuguugaaggaguc

 - 274

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20042113 "MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana" Grant-Downton R, Le Trionnaire G, Schmid R, Rodriguez-Enriquez J, Hafidh S, Mehdi S, Twell D, Dickinson H BMC Genomics. 10:643(2009).