Stem-loop sequence ath-MIR2933b

AccessionMI0013363 (change log)
DescriptionArabidopsis thaliana miR2933b stem-loop
Gene family MIPF0001072; MIR2933
Literature search

1 open access papers mention ath-MIR2933b
(1 sentences)

Stem-loop
   gaaa   g  gg        ag        ga a g     - g  gg       g 
5'     uuc uu  cgauuuug  ugaaaucg  g g gaauu c uc  ugauuuu a
       ||| ||  ||||||||  ||||||||  | | ||||| | ||  |||||||  
3'     aag ag  gcuaaagu  guuuuagc  c c cuuaa g ag  gcuaaag g
   cuaa   g  ag        ga        gg - g     a g  ag       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 17402762-17402873 [-]
intergenic
Database links

Mature sequence ath-miR2933b

Accession MIMAT0014137
Sequence

59 - 

gaaaucggagaggaaauucgcc

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20042113 "MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana" Grant-Downton R, Le Trionnaire G, Schmid R, Rodriguez-Enriquez J, Hafidh S, Mehdi S, Twell D, Dickinson H BMC Genomics. 10:643(2009).