Stem-loop sequence api-mir-10

AccessionMI0013354 (change log)
DescriptionAcyrthosiphon pisum miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention api-mir-10
(5 sentences)

Stem-loop
   -    u      cu   -  g    u           ugaa 
5'  augc cuacau  acc cu uaga ccgaauuuguu    a
    |||| ||||||  ||| || |||| |||||||||||    a
3'  uacg ggugug  ugg ga aucu ggcuuaaacag    a
   a    u      uu   a  g    u           cggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350757.1: 17838-17920 [+]
intergenic
Database links

Mature sequence api-miR-10

Accession MIMAT0014128
Sequence

14 - 

acccuguagauccgaauuugu

 - 34

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).