Stem-loop sequence osa-MIR395y

AccessionMI0013351 (change log)
DescriptionOryza sativa miR395y stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395y
(173 sentences)

Stem-loop
   u   c  ag         g             -   aac     uuacuc     ca 
5'  ggc cc  gaguuccuu caagcacuucaca uag   uucag      ucaua  a
    ||| ||  ||||||||| ||||||||||||| |||   |||||      |||||   
3'  ccg gg  cucaagggg guuugugaagugu auc   gaguu      agugu  c
   a   u  cu         -             u   gaa     ----uu     ua 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3299815-3299924 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395y
osa-MIR395hChr8: 3299144-3299255 [+]
osa-MIR395iChr8: 3299319-3299417 [+]
osa-MIR395jChr8: 3299479-3299590 [+]
osa-MIR395kChr8: 3299652-3299750 [+]
osa-MIR395yChr8: 3299815-3299924 [+]
osa-MIR395lChr8: 3299997-3300090 [+]
Database links

Mature sequence osa-miR395y

Accession MIMAT0014125
Sequence

81 - 

gugaaguguuugggggaacuc

 - 101

Get sequence
Deep sequencing41 reads, 2 experiments
Evidence not experimental
Database links

References

1