Stem-loop sequence osa-MIR395x

AccessionMI0013350 (change log)
DescriptionOryza sativa miR395x stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395x
(166 sentences)

Stem-loop
   a      au     u     cu        u       -  a    aa 
5'  uuuggu  cgcca gaguu  cuucaaac cuucaua cg cacu  u
    ||||||  ||||| |||||  |||||||| ||||||| || ||||   
3'  aaacca  guggu cucga  gagguuug gaagugu gu guga  u
   c      cu     u     -u        u       u  a    ac 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 32623067-32623162 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395x
osa-MIR395mChr4: 32621993-32622112 [+]
osa-MIR395nChr4: 32622243-32622308 [+]
osa-MIR395oChr4: 32622381-32622449 [+]
osa-MIR395pChr4: 32622525-32622592 [+]
osa-MIR395qChr4: 32622668-32622735 [+]
osa-MIR395rChr4: 32622811-32622878 [+]
osa-MIR395sChr4: 32622943-32623028 [+]
osa-MIR395xChr4: 32623067-32623162 [+]
Database links

Mature sequence osa-miR395x

Accession MIMAT0014124
Sequence

61 - 

gugaaguguuuggaguagcuc

 - 81

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence not experimental

References

1