Stem-loop sequence bma-mir-281

AccessionMI0013349 (change log)
DescriptionBrugia malayi miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   -ggu        a  -ac         -ca     u      --  u 
5'     gaacgcag cg   aaagagagc   ucugu gacagu  ca a
       |||||||| ||   |||||||||   ||||| ||||||  || u
3'     cuuguguc gu   uuucucucg   aggua cuguca  gu a
   gaau        c  aca         uua     -      ac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold18: 454490-454580 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-281
bma-mir-281Bmal_v3_scaffold18: 454490-454580 [-]
bma-mir-9535Bmal_v3_scaffold18: 451722-451824 [+]
Database links

Mature sequence bma-miR-281-5p

Accession MIMAT0037378
Sequence

18 - 

aagagagccaucuguugacagu

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bma-miR-281-3p

Accession MIMAT0014123
Sequence

53 - 

ugucauggaauugcucucuuua

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).