|
miRBase |
|
Stem-loop sequence bma-mir-281 |
|
| Accession | MI0013349 |
| Description | Brugia malayi miR-281 stem-loop |
| Gene family | MIPF0000087; mir-46 |
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors. |
| Stem-loop |
-ggu a -ac -ca u -- u
gaacgcag cg aaagagagc ucugu gacagu ca a
|||||||| || ||||||||| ||||| |||||| || u
cuuguguc gu uuucucucg aggua cuguca gu a
gaau c aca uua - ac u
|
Mature sequence bma-miR-281 |
|
| Accession | MIMAT0014123 |
| Sequence |
53 - ugucauggaauugcucucuuua - 74 |
| Evidence | by similarity; MI0000366 |
References |
|
| 1 |
PMID:19874857
"Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi"
Mol Biochem Parasitol. 169:87-94(2010).
|