Stem-loop sequence bma-mir-279

AccessionMI0013348 (change log)
DescriptionBrugia malayi miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention bma-mir-279
(6 sentences)

Stem-loop
   --------------   uu          c        u       ugg aug 
5'               uca  cguagcugag augguucu agucaug   c   u
                 |||  |||||||||| |||||||| |||||||   |    
3'               agu  guaucgacuc uaccaaga ucaguac   g   a
   aauucuuacggccc   --          a        -       uua aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold435: 4948-5038 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-279
bma-mir-279Bmal_v3_scaffold435: 4948-5038 [-]
bma-mir-250Bmal_v3_scaffold435: 3185-3292 [-]
bma-mir-2cBmal_v3_scaffold435: 2942-3032 [-]
bma-mir-5841Bmal_v3_scaffold435: 2745-2879 [-]
Database links

Mature sequence bma-miR-279

Accession MIMAT0014122
Sequence

51 - 

ugacuagaaccauacucagc

 - 70

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).