Stem-loop sequence bma-mir-228

AccessionMI0013346 (change log)
DescriptionBrugia malayi miR-228 stem-loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention bma-mir-228
(2 sentences)

Stem-loop
       g     ua   a    c   a a     u     uucacc 
5' ugcu gcaca  cuc augg acu g ugaau cacgg      u
   |||| |||||  ||| |||| ||| | ||||| |||||       
3' auga cgugu  gag uacc uga c gcuua gugcc      c
       a     -c   a    u   c -     u     uauccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold9: 494383-494470 [+]
intergenic
Database links

Mature sequence bma-miR-228

Accession MIMAT0014120
Sequence

16 - 

aauggcacuagaugaauucacgg

 - 38

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).