Stem-loop sequence bma-mir-153

AccessionMI0013345 (change log)
DescriptionBrugia malayi miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

2 open access papers mention bma-mir-153
(5 sentences)

Stem-loop
   -----uuc    ---    g            g    -      --   u 
5'         cgcu   cguc aucauuuuugug auua gcaauu  uug u
           ||||   |||| |||||||||||| |||| ||||||  |||  
3'         gcga   gcag uagugaaaacac ugau cguuaa  agc c
   uguuugcu    agu    g            -    a      ua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bma-miR-153

Accession MIMAT0014119
Sequence

50 - 

uugcauagucacaaaagugaug

 - 71

Get sequence
Evidence experimental; Northern [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).