Stem-loop sequence bma-mir-133

Accession MI0013343
Description Brugia malayi miR-133 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u        caag  a   uau  c   cauuu     c       u  uc  a    a   uuauau 
 ugauugga    gu ugc   ga gga     acaua cugguug ag  ga ccaa uug      u
 ||||||||    || |||   || |||     ||||| ||||||| ||  || |||| |||      u
 auugaucu    ca aug   cu ccu     uguau gaccaac uc  cu gguu aac      u
a        ---a  a   -uc  -   --cuu     c       u  cc  -    -   uaaaau 
Get sequence

Mature sequence bma-miR-133

Accession MIMAT0014117
Sequence

81 - 

uugguccccuucaaccagcua

 - 101

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).