Stem-loop sequence bma-mir-124

Accession

MI0013342

Description

Brugia malayi miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

--------   -       cuc  u       -   a       -   uu 
        caa aggacgu   gc uucaccg gug ccuuggu uug  a
        ||| |||||||   || ||||||| ||| ||||||| |||  u
        guu ucuugca   cg aaguggc cac ggaauca gau  g
uccauauc   c       aac  u       g   -       u   uu 

Mature sequence bma-miR-124

• Accession: MIMAT0014116
• Sequence: 51 - uaaggcacgcggugaaugccaa - 72
• Evidence: experimental; Northern [1]

References

1. PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).