Stem-loop sequence bma-mir-100d

AccessionMI0013341 (change log)
DescriptionBrugia malayi miR-100d stem-loop
Literature search

2 open access papers mention bma-mir-100d
(18 sentences)

Stem-loop
   --u  ug       a cua     a cu    a       g ga a 
5'    gu  gugugug c   cccgu g  ccga uaugugu g  c a
      ||  ||||||| |   ||||| |  |||| ||||||| |  | a
3'    ca  uacacac g   gggca c  ggcu auacaca c  g u
   agu  gu       c aaa     - cu    -       a ac u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold84: 110616-110706 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-100d
bma-mir-100dBmal_v3_scaffold84: 110616-110706 [-]
bma-mir-100aBmal_v3_scaffold84: 109699-109789 [-]
Database links

Mature sequence bma-miR-100d

Accession MIMAT0014115
Sequence

16 - 

uacccguagcuccgaauaugug

 - 37

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).