Stem-loop sequence bma-mir-100c

AccessionMI0013340 (change log)
DescriptionBrugia malayi miR-100c stem-loop
Literature search

3 open access papers mention bma-mir-100c
(20 sentences)

Stem-loop
   guuuu     a     u     u   a       u au 
5'      cgauc acccg agaac gaa ucguguu g  u
        ||||| ||||| ||||| ||| ||||||| |  u
3'      guuag ugggc ucuug cuu agcacaa c  u
   cguuc     c     -     u   -       - gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold1: 4628686-4628761 [-]
intergenic
Database links

Mature sequence bma-miR-100c

Accession MIMAT0014114
Sequence

11 - 

aacccguagaacugaaaucgug

 - 32

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).