Stem-loop sequence bma-mir-100b

AccessionMI0013339 (change log)
DescriptionBrugia malayi miR-100b stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention bma-mir-100b
(25 sentences)

Stem-loop
   gugugaggua    a     a     uagau    a  ug    ga  uu 
5'           gcac cgguc acccg     ccga cu  uguu  ga  u
             |||| ||||| |||||     |||| ||  ||||  ||   
3'           ugug gucag ugggc     ggcu ga  acaa  cu  u
   ----------    c     a     -uuac    g  gu    gc  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold247: 48104-48194 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-100b
bma-mir-100bBmal_v3_scaffold247: 48104-48194 [-]
bma-let-7Bmal_v3_scaffold247: 47896-48019 [-]
Database links

Mature sequence bma-miR-100b

Accession MIMAT0014113
Sequence

21 - 

aacccguagauccgaacuugug

 - 42

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).