Stem-loop sequence bma-mir-100a

AccessionMI0013338 (change log)
DescriptionBrugia malayi miR-100a stem-loop
Literature search

3 open access papers mention bma-mir-100a
(20 sentences)

Stem-loop
   cggcauggcggcugu     a     u  uu    a         a au 
5'                cgguu acccg ag  ucga cauguguug u  a
                  ||||| ||||| ||  |||| ||||||||| |   
3'                guuaa ugggc uc  ggcu guacacaau g  u
   -------gaucauuc     c     -  uu    -         a au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold84: 109699-109789 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-100a
bma-mir-100dBmal_v3_scaffold84: 110616-110706 [-]
bma-mir-100aBmal_v3_scaffold84: 109699-109789 [-]
Database links

Mature sequence bma-miR-100a

Accession MIMAT0014112
Sequence

21 - 

aacccguaguuucgaacaugug

 - 42

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).