Stem-loop sequence bma-mir-92

AccessionMI0013337 (change log)
DescriptionBrugia malayi miR-92 stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention bma-mir-92
(8 sentences)

Stem-loop
   cauacu   -    u  g        a u  uu    c    caga    a u 
5'       gca cuaa ca ucaggucg g cg  ugca uauu    caga g u
         ||| |||| || |||||||| | ||  |||| ||||    |||| | c
3'       cgu gauu gu aguccggc c gc  acgu auag    guuu c a
   uauuau   c    -  g        c u  uc    u    --cg    a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold1: 1946337-1946441 [-]
intergenic
Database links

Mature sequence bma-miR-92

Accession MIMAT0014111
Sequence

67 - 

uauugcacucgucccggccu

 - 86

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).