Stem-loop sequence bma-mir-72

AccessionMI0013333 (change log)
DescriptionBrugia malayi miR-72 stem-loop
Gene family MIPF0000277; mir-72
Literature search

2 open access papers mention bma-mir-72
(2 sentences)

Stem-loop
   ucaugggacacgggacaa   aa     u     a     acaugauaacgauuaggcucuaguu 
5'                   ggc  gaugu ggcau gcuga                         u
                     |||  ||||| ||||| |||||                          
3'                   ccg  uuaca ccgug cgacu                         a
   ----------------ua   ga     -     a     ucgagauacguuuaacuaauccgag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold8: 872016-872130 [-]
intergenic
Database links

Mature sequence bma-miR-72

Accession MIMAT0014107
Sequence

18 - 

aggcaagauguuggcauagcuga

 - 40

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).