Stem-loop sequence bma-mir-57

AccessionMI0013331 (change log)
DescriptionBrugia malayi miR-57 stem-loop
Gene family MIPF0000271; mir-57
Literature search

1 open access papers mention bma-mir-57
(4 sentences)

Stem-loop
   cuuuuu    -uu    guc     u   gu     gc     c  agu 
5'       gagc   guuc   uaccc gug  accga  ugugu ug   g
         ||||   ||||   ||||| |||  |||||  ||||| ||   a
3'       cucg   cagg   auggg cac  uggcu  gcaca ac   u
   -----u    uuc    -aa     u   --     -a     a  gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold28: 44889-44979 [+]
intergenic
Database links

Mature sequence bma-miR-57

Accession MIMAT0014105
Sequence

20 - 

uacccugugguaccgagcugugucu

 - 44

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).