Stem-loop sequence bma-mir-36c

AccessionMI0013328 (change log)
Previous IDsbma-mir-36a
DescriptionBrugia malayi miR-36c stem-loop
Gene family MIPF0000096; mir-36
Literature search

1 open access papers mention bma-mir-36c
(15 sentences)

Stem-loop
   ---------------uag    u         c    a    a    ---   a 
5'                   cuau cgggauagu ucuc cggu gagc   uug a
                     |||| ||||||||| |||| |||| ||||   ||| a
3'                   gaua gccuuguua agag gcca cucg   aac a
   cugccuuuacauggcaug    c         c    -    -    uuu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold153: 3437-3527 [+]
intergenic
Clustered miRNAs
< 10kb from bma-mir-36c
bma-mir-2b-2Bmal_v3_scaffold153: 3307-3398 [+]
bma-mir-36cBmal_v3_scaffold153: 3437-3527 [+]
bma-mir-5840Bmal_v3_scaffold153: 6986-7093 [+]
bma-mir-2b-1Bmal_v3_scaffold153: 8299-8390 [+]
bma-mir-36bBmal_v3_scaffold153: 8423-8513 [+]
Database links

Mature sequence bma-miR-36c-5p

Accession MIMAT0037376
Sequence

9 - 

cgggauagucucucacgguagagc

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bma-miR-36c-3p

Accession MIMAT0014102
Previous IDsbma-miR-36a
Sequence

49 - 

ucaccggagacauuguuccgca

 - 70

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).