Stem-loop sequence bma-mir-34

AccessionMI0013327 (change log)
DescriptionBrugia malayi miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

2 open access papers mention bma-mir-34
(5 sentences)

Stem-loop
   ---------ccaaau  --g    uuu      -        -    u     g     agc 
5'                ac   ggga   accggg uggcagug uggu agcug uuguc   a
                  ||   ||||   |||||| |||||||| |||| ||||| |||||   u
3'                ug   uccu   uggucc gccgucac acua ucggc aacag   a
   uguccuucuacgacu  aaa    -uu      u        u    -     -     gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold3: 1411673-1411783 [+]
intergenic
Database links

Mature sequence bma-miR-34

Accession MIMAT0014101
Sequence

23 - 

uggcagugugguuagcugguugu

 - 45

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).