Stem-loop sequence bma-mir-9

Accession MI0013326
Description Brugia malayi miR-9 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      caa   ua       u        g     -  a    
guauug   cuu  cuuuggu aucuagcu uauga gu agu 
||||||   |||  ||||||| |||||||| ||||| || || u
cauaac   gaa  gaaacca uggaucga auacu cg uca 
      -ac   uc       u        a     u  g    
Get sequence

Mature sequence bma-miR-9

Accession MIMAT0014100
Sequence

15 - 

cuuugguuaucuagcuguauga

 - 36

Get sequence
Evidence by similarity; MI0000129

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).