Stem-loop sequence bma-mir-9

AccessionMI0013326 (change log)
DescriptionBrugia malayi miR-9 stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention bma-mir-9
(9 sentences)

Stem-loop
         caa   ua       u        g     -  a    
5' guauug   cuu  cuuuggu aucuagcu uauga gu agu 
   ||||||   |||  ||||||| |||||||| ||||| || || u
3' cauaac   gaa  gaaacca uggaucga auacu cg uca 
         -ac   uc       u        a     u  g    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold1: 3047960-3048044 [-]
intergenic
Database links

Mature sequence bma-miR-9-5p

Accession MIMAT0014100
Sequence

15 - 

cuuugguuaucuagcuguauga

 - 36

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bma-miR-9-3p

Accession MIMAT0014108
Sequence

53 - 

auaaagcuagguuaccaaagcu

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).