Stem-loop sequence bma-mir-2c

AccessionMI0013324 (change log)
DescriptionBrugia malayi miR-2c stem-loop
Literature search

3 open access papers mention bma-mir-2c
(30 sentences)

Stem-loop
   ----------caaauc          u    -   uu     a   uguaa 
5'                 ucgugagccg aucg gcu  guggu cau     u
                   |||||||||| |||| |||  ||||| |||      
3'                 agcgcucggc uagc cga  cacua gua     u
   uacuuuuuaauuguga          u    a   --     c   uuggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold435: 2942-3032 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2c
bma-mir-279Bmal_v3_scaffold435: 4948-5038 [-]
bma-mir-250Bmal_v3_scaffold435: 3185-3292 [-]
bma-mir-2cBmal_v3_scaffold435: 2942-3032 [-]
bma-mir-5841Bmal_v3_scaffold435: 2745-2879 [-]
Database links

Mature sequence bma-miR-2c

Accession MIMAT0014098
Sequence

51 - 

caucacagcacgauucggcuc

 - 71

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).