Stem-loop sequence bma-mir-2b-2

Accession MI0013323
Description Brugia malayi miR-2b-2 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--------------ga     a        --         a  uu  murru 
                gcggu guuguauc  gucugugau ug  gu     u
                ||||| ||||||||  ||||||||| ||  ||     g
                cguca cgacguag  cagacacua ac  cg     g
gcccucaucguguuca     g        cc         c  -u  uuguu 
Get sequence

Mature sequence bma-miR-2b

Accession MIMAT0014097
Sequence

52 - 

aucacagacccgaugcagcga

 - 72

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).