Stem-loop sequence bma-mir-2b-1

AccessionMI0013322 (change log)
DescriptionBrugia malayi miR-2b-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention bma-mir-2b-1
(36 sentences)

Stem-loop
   --------------ga     a          --       a  uu   ugau 
5'                 gcggu guuguaucgg  cugugau ug  gua    u
                   ||||| ||||||||||  ||||||| ||  |||    g
3'                 cguca cgacguagcc  gacacua ac  cgu    g
   gcccucaucguguuca     g          ca       c  -u   uguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold153: 8299-8390 [+]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2b-1
bma-mir-2b-2Bmal_v3_scaffold153: 3307-3398 [+]
bma-mir-36cBmal_v3_scaffold153: 3437-3527 [+]
bma-mir-5840Bmal_v3_scaffold153: 6986-7093 [+]
bma-mir-2b-1Bmal_v3_scaffold153: 8299-8390 [+]
bma-mir-36bBmal_v3_scaffold153: 8423-8513 [+]
bma-mir-2dBmal_v3_scaffold153: 15939-16048 [+]
bma-mir-36dBmal_v3_scaffold153: 16078-16186 [+]
bma-mir-2iBmal_v3_scaffold153: 16336-16445 [+]
Database links

Mature sequence bma-miR-2b-3p

Accession MIMAT0014097
Sequence

52 - 

aucacagacccgaugcagcga

 - 72

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).