Stem-loop sequence bma-mir-2a

AccessionMI0013321 (change log)
DescriptionBrugia malayi miR-2a stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention bma-mir-2a
(31 sentences)

Stem-loop
   ------------uucuc             -    ca        --ucg a 
5'                  cgacacgucaaag uggu  gugaugug     c a
                    ||||||||||||| ||||  ||||||||     | a
3'                  guuguguaguuuc accg  cacuauac     g a
   uacccagcuguucgcgu             g    -a        uuaaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold75: 41811-41901 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2a
bma-mir-71Bmal_v3_scaffold75: 45674-45764 [-]
bma-mir-2aBmal_v3_scaffold75: 41811-41901 [-]
Database links

Mature sequence bma-miR-2a

Accession MIMAT0014096
Sequence

50 - 

uaucacagccagcuuugaugu

 - 70

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).