Stem-loop sequence bma-lin-4

AccessionMI0013320 (change log)
DescriptionBrugia malayi lin-4 stem-loop
Gene family MIPF0000303; lin-4
Literature search

3 open access papers mention bma-lin-4
(4 sentences)

Stem-loop
   aaa     cuugc     ucu       -ac    -    c   a  a 
5'    gaaag     gaccu   cccugag   cucu gcug gac gu c
      |||||     |||||   |||||||   |||| |||| ||| || g
3'    cuuuc     cugga   gggacuc   gaga cgac cug cg u
   -ag     -----     ccu       cau    a    a   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold17: 230335-230424 [-]
intergenic
Database links

Mature sequence bma-lin-4

Accession MIMAT0014095
Sequence

21 - 

ucccugagaccucugcugcga

 - 41

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).