Stem-loop sequence bma-let-7

Accession MI0013319
Description Brugia malayi let-7 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
augcuaac   ccu  a      -     u  au   g          u      ---a   -gu    
        gac   ga ugauag cuugc cg  gag uaguagguug auaguu    uga   ugu 
        |||   || |||||| ||||| ||  ||| |||||||||| ||||||    |||   || a
        cug   cu acuauc gggcg gc  uuc aucguccgac ugucaa    gcu   acc 
-----ccc   --c  -      u     u  cg   g          c      agag   aau    
Get sequence

Mature sequence bma-let-7

Accession MIMAT0014094
Sequence

33 - 

ugagguaguagguuguauaguu

 - 54

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).