Stem-loop sequence ctr-MIR166

Accession

MI0013297

Description

Citrus trifoliata miR166 stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

gguuugucugaaggaucuaggguuaauugggaagcuuuuucuuuugaggggaauguugucuggcucgaggccacuaacuagaucuuugauuuaaucucaguugaucauauauuuguuucauuuuucuuccauaaaauuuaauuauauugagauacccaucauugaucuuaagauaauuaaguuagugacgucggaccaggcuucauuccccccaauaauugcuucuaucugcuaugauaucaucuucauuucuuggaggugcugugaucaguucucaaacuu    ug -u       ca   -uu  uu        auuuauugaucuuguguuguguauauuugu 
                                                                                                                                                                                                                                                                                          uagu  a  uuuuuca  auu   uc  uuuguuua                              a
                                                                                                                                                                                                                                                                                          ||||  |  |||||||  |||   ||  ||||||||                               
                                                                                                                                                                                                                                                                                          guca  u  agaaagu  uaa   gg  agacgagu                              u
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------    gu uu       ag   ugu  uu        accgguuacugguucuagagaggcaacugg 

Mature sequence ctr-miR166

• Accession: MIMAT0014071
• Sequence: 191 - ucggaccaggcuucauuccccc - 212
• Evidence: experimental; Northern [1]

References

1. PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).