Stem-loop sequence csi-MIR166e

Accession

MI0013296

Previous IDs

csi-MIR166

Description

Citrus sinensis miR166e stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

-g      uuuu   u   a        uu      cu   g   a   --cuu     -   auuaauuuuacguauucucucauagau 
  gggagc    ugu uug ggggaaug  gucugg  cga gac cua     guuga ucc                           c
  ||||||    ||| ||| ||||||||  ||||||  ||| ||| |||     ||||| |||                           u
  ucuucg    aua aac ccccuuac  cggacc  gcu cug ggu     cgacu agg                           a
ua      --uu   u   c        uu      ag   g   c   uuauu     u   cauauaacaauaggugguaagucuacg 

Mature sequence csi-miR166e-5p

• Accession: MIMAT0017386
• Previous IDs: csi-miR166e*
• Sequence: 22 - ggaauguugucuggcucgagg - 42
• Evidence: experimental; Solexa [2]

Mature sequence csi-miR166e-3p

• Accession: MIMAT0014070
• Previous IDs: csi-miR166;csi-miR166e
• Sequence: 139 - ucggaccaggcuucauucccc - 159
• Evidence: experimental; Solexa [2]

References

1. PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2. PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).