Stem-loop sequence rlcv-mir-rL1-18

Accession

MI0013277 (change log)

Description

Rhesus lymphocryptovirus miR-rL1-18 stem-loop

Stem-loop

           g   u       u     c   guau      au 
5' aggugugg guu agaugau ggggg ggc    cuuuug  u
   |||||||| ||| ||||||| ||||| |||    ||||||   
3' uuuacacc cag ucuacua cccuc ccg    gaaaau  u
           a   u       c     c   -auu      gg 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Database links

• miRBase Tracker:MI0013277

Mature sequence rlcv-miR-rL1-18-5p

• Accession: MIMAT0019186
• Previous IDs: rlcv-mir-rL1-18-5p
• Sequence: 13 - uagaugauugggggcggcguauc - 35
• Evidence: experimental; Illumina [2-3]

Mature sequence rlcv-miR-rL1-18-3p

• Accession: MIMAT0016941
• Previous IDs: rlcv-miR-rL1-18
• Sequence: 53 - uuagccccuccccaucaucuug - 74
• Evidence: experimental; Northern [1], PCR [1], Illumina [2-3]

References

1. PMID:19889779 "A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs" Walz N, Christalla T, Tessmer U, Grundhoff A J Virol. 84:716-728(2010).
2. PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3. PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).