Stem-loop sequence osa-MIR2931

AccessionMI0013273 (change log)
DescriptionOryza sativa miR2931 stem-loop
Stem-loop
   ----------------------------aaaaaa      --u  cc     --u   uu  a ug     uuuaugucuuu         gucaaa 
5'                                   caaugu   ug  acuuc   uua  uu u  augca           auuguugau      a
                                     ||||||   ||  |||||   |||  || |  |||||           |||||||||      a
3'                                   guuaua   au  ugaag   gau  aa a  uacgu           uggcgacua      u
   uaccucccccaaguauuaacaugguguucauaua      uau  au     uuc   uu  a gu     -----------         gcuauu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 1893771-1893924 [+]
intergenic
Database links

Mature sequence osa-miR2931

Accession MIMAT0014062
Sequence

47 - 

cuuuauuguugaugucaaaa

 - 66

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).