Stem-loop sequence sbi-MIR172f

AccessionMI0013256 (change log)
DescriptionSorghum bicolor miR172f stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention sbi-MIR172f
(30 sentences)

Stem-loop
   --                  a   -      aacaccguugggugggugcaguuaccca 
5'   gcggcaucaucaggauuc cac cgggua                            u
     |||||||||||||||||| ||| ||||||                            g
3'   cgucguaguaguccuaag gug guucgu                            c
   ca                  a   c      ugucuaucucggucuggacguauauaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr5: 19295951-19296068 [-]
intergenic
Database links

Mature sequence sbi-miR172f

Accession MIMAT0014045
Sequence

98 - 

agaauccugaugaugcugcac

 - 118

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).