Stem-loop sequence sbi-MIR169q

AccessionMI0013255 (change log)
DescriptionSorghum bicolor miR169q stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

4 open access papers mention sbi-MIR169q
(23 sentences)

Stem-loop
   --              cu    u   -     u    ug     --    g agg 
5'   uuagccaagaaugg  ugcc auc uccau auuu  uucau  cgau c   c
     ||||||||||||||  |||| ||| ||||| ||||  |||||  |||| |    
3'   aaucgguucuuacc  acgg uag aggug uaaa  aggua  gcua g   c
   ug              -u    -   u     -    gu     cu    g gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 12317865-12317968 [-]
intergenic
Database links

Mature sequence sbi-miR169q

Accession MIMAT0014044
Sequence

2 - 

uagccaagaauggcuugccua

 - 22

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).