Stem-loop sequence sbi-MIR169p

AccessionMI0013254 (change log)
DescriptionSorghum bicolor miR169p stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

4 open access papers mention sbi-MIR169p
(23 sentences)

Stem-loop
   --       a   u    u   u   -     u    g        -      cc 
5'   uuagcca gaa ggcu gcc auc uccau auuu guucauca gaggga  u
     ||||||| ||| |||| ||| ||| ||||| |||| |||||||| ||||||  c
3'   aaucggu cuu ccga cgg uag aggug uaaa uagguagu cucccu  u
   ug       -   c    -   -   u     -    g        a      ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 1349656-1349760 [+]
intergenic
Database links

Mature sequence sbi-miR169p

Accession MIMAT0014043
Sequence

2 - 

uagccaagaauggcuugccua

 - 22

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).