Stem-loop sequence osa-MIR2907d

AccessionMI0013250 (change log)
DescriptionOryza sativa miR2907d stem-loop
Gene family MIPF0000861; MIR2907
Literature search

1 open access papers mention osa-MIR2907d
(1 sentences)

Stem-loop
      gc     uaucucca   a   --   c   a 
5' gag  acccc        ccc cgc  ggc gcc c
   |||  |||||        ||| |||  ||| |||  
3' cuc  ugggg        ggg gcg  ccg cgg a
      aa     ----cucc   a   ag   a   u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 12115090-12115155 [+]
intergenic
Database links

Mature sequence osa-miR2907d

Accession MIMAT0014039
Sequence

37 - 

ggcagccgagcgagggccucgg

 - 58

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:19796675 "Identification of novel stress-regulated microRNAs from Oryza sativa L" Jian X, Zhang L, Li G, Zhang L, Wang X, Cao X, Fang X, Chen F Genomics. 95:47-55(2010).