Stem-loop sequence osa-MIR2907c

AccessionMI0013249 (change log)
DescriptionOryza sativa miR2907c stem-loop
Literature search

1 open access papers mention osa-MIR2907c
(1 sentences)

Stem-loop
         cagcc   c -a             aagccgcgggagagc 
5' gcgcgg     gag g  gggccucggggcg               c
   ||||||     ||| |  |||||||||||||                
3' cgcgcc     cuc c  cccggagccccgu               c
         -----   c cc             acugcagugggggag 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 11906614-11906701 [+]
intergenic
Database links

Mature sequence osa-miR2907c

Accession MIMAT0014038
Sequence

5 - 

ggcagccgagcgagggccucgg

 - 26

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Northern [1]

References

1
PMID:19796675 "Identification of novel stress-regulated microRNAs from Oryza sativa L" Jian X, Zhang L, Li G, Zhang L, Wang X, Cao X, Fang X, Chen F Genomics. 95:47-55(2010).