Stem-loop sequence osa-MIR2907b

AccessionMI0013248 (change log)
DescriptionOryza sativa miR2907b stem-loop
Gene family MIPF0000861; MIR2907
Literature search

1 open access papers mention osa-MIR2907b
(1 sentences)

Stem-loop
       accuc    ucc    --       ca  a 
5' gagc     uccc   gccc  gcucggc  cc c
   ||||     ||||   ||||  |||||||  ||  
3' cucg     gggg   cggg  cgagccg  gg g
       ---ac    cuc    ag       ac  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 7278025-7278089 [+]
intergenic
Database links

Mature sequence osa-miR2907b

Accession MIMAT0014037
Sequence

36 - 

ggcagccgagcgagggccucgg

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Northern [1]

References

1
PMID:19796675 "Identification of novel stress-regulated microRNAs from Oryza sativa L" Jian X, Zhang L, Li G, Zhang L, Wang X, Cao X, Fang X, Chen F Genomics. 95:47-55(2010).