Stem-loop sequence osa-MIR2907a

AccessionMI0013247 (change log)
DescriptionOryza sativa miR2907a stem-loop
Gene family MIPF0000861; MIR2907
Literature search

1 open access papers mention osa-MIR2907a
(1 sentences)

Stem-loop
       a     cucucc    --a      ca  a 
5' gagc gcucu      gccc   cuuggc  cc c
   |||| |||||      ||||   ||||||  ||  
3' uucg cgggg      cggg   gagccg  gg g
       a     ---cuc    agc      ac  c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 23598551-23598615 [+]
intergenic
Database links

Mature sequence osa-miR2907a

Accession MIMAT0014036
Sequence

36 - 

ggcagccgagcgagggccucgg

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Northern [1]

References

1
PMID:19796675 "Identification of novel stress-regulated microRNAs from Oryza sativa L" Jian X, Zhang L, Li G, Zhang L, Wang X, Cao X, Fang X, Chen F Genomics. 95:47-55(2010).