Stem-loop sequence zma-MIR390b

AccessionMI0013244 (change log)
DescriptionZea mays miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

13 open access papers mention zma-MIR390b
(97 sentences)

Stem-loop
   -- a         g         cua   ------a    c c      u      ac  a  -   --a       u a                       
5'   g agcucagga ggauagcgc   gga       auca a auagau ggagcc  ga ga gga   gggagaa g gagagagagagacagagcagcu 
     | ||||||||| |||||||||   |||       |||| | |||||| ||||||  || || |||   ||||||| | ||||||||||||||||||||| a
3'   c ucgaguccu ucuaucgcg   ccu       uagu u uaucug ucuugg  cu cu ccu   uucucuu c cucucucucucugucucgucgu 
   ca c         a         aag   agcuaag    a a      -      aa  -  a   agg       u a                       
Get sequence
Deep sequencing
1387 reads, 441 reads per million, 145 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 2846327-2846518 [+]
intergenic
Database links

Mature sequence zma-miR390b-5p

Accession MIMAT0014033
Previous IDszma-miR390b
Sequence

2 - 

aagcucaggagggauagcgcc

 - 22

Get sequence
Deep sequencing1073 reads, 114 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR390b-3p

Accession MIMAT0015367
Previous IDszma-miR390b*
Sequence

171 - 

cgcuaucuauccugagcucca

 - 191

Get sequence
Deep sequencing124 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).