Stem-loop sequence zma-MIR1432

AccessionMI0013243 (change log)
DescriptionZea mays miR1432 stem-loop
Gene family MIPF0001063; MIR1432
Literature search

8 open access papers mention zma-MIR1432
(17 sentences)

Stem-loop
   -   -    a           g  gc         -----    c a 
5'  gcu cagg gagaugacacc ac  cagacggac     cggu c u
    ||| |||| ||||||||||| ||  |||||||||     |||| |  
3'  cga gucc cucuacugugg ug  gucugccug     gccg g c
   a   a    g           g  aa         ucugu    c c 
Get sequence
Deep sequencing
3287 reads, 2.7e+03 reads per million, 169 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 165932790-165932878 [-]
intergenic
Database links

Mature sequence zma-miR1432-5p

Accession MIMAT0014032
Previous IDszma-miR1432
Sequence

2 - 

cucaggagagaugacaccgac

 - 22

Get sequence
Deep sequencing139 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR1432-3p

Accession MIMAT0015366
Previous IDszma-miR1432*
Sequence

68 - 

gggugucaucucgccugaagca

 - 89

Get sequence
Deep sequencing25 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).