Stem-loop sequence zma-MIR529

AccessionMI0013241 (change log)
DescriptionZea mays miR529 stem-loop
Gene family MIPF0000388; MIR529
Literature search

14 open access papers mention zma-MIR529
(65 sentences)

Stem-loop
   --            a          -   gc   guac     -----   a  uc      cucu 
5'   gagaagagagag guacagccuu guu  cau    acacu     cag ua  aacagu    u
     |||||||||||| |||||||||| |||  |||    |||||     ||| ||  ||||||    a
3'   uucuucucucuc caugucggaa uag  gug    uguga     guc au  uugucg    u
   uc            c          g   ua   -acc     uuauu   c  ca      uuua 
Get sequence
Deep sequencing
2676 reads, 4.6e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 164370906-164371031 [+]
intergenic
Database links

Mature sequence zma-miR529-5p

Accession MIMAT0014030
Previous IDszma-miR529
Sequence

2 - 

agaagagagagaguacagccu

 - 22

Get sequence
Deep sequencing2639 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR529-3p

Accession MIMAT0015364
Previous IDszma-miR529*
Sequence

105 - 

gcuguacccucucucuucuuc

 - 125

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).