Stem-loop sequence zma-MIR528b

AccessionMI0013240 (change log)
DescriptionZea mays miR528b stem-loop
Gene family MIPF0000868; MIR528
Literature search

18 open access papers mention zma-MIR528b
(106 sentences)

Stem-loop
   -            u   g     cacg       u  g 
5'  guggaaggggca gca aggag    aacgagg gu g
    |||||||||||| ||| |||||    ||||||| || u
3'  uaccuucuccgu cgu uccuc    uugcucc cg u
   u            c   g     ucga       c  g 
Get sequence
Deep sequencing
3462 reads, 1.9e+03 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 156643654-156643731 [-]
intergenic
Database links

Mature sequence zma-miR528b-5p

Accession MIMAT0014029
Previous IDszma-miR528b
Sequence

2 - 

uggaaggggcaugcagaggag

 - 22

Get sequence
Deep sequencing3337 reads, 27 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR528b-3p

Accession MIMAT0015363
Previous IDszma-miR528b*
Sequence

58 - 

ccugugccugccucuuccauu

 - 78

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).